Semi-supervised isofrom detection and annotation for long read data. This variant is
meant for single sample scRNA-seq data. Specific parameters can be configured in
the config file (see create_config), input files are specified via
arguments.
Usage
SingleCellPipeline(
config_file,
outdir,
fastq,
annotation,
genome_fa,
genome_mmi,
minimap2,
samtools,
barcodes_file,
expect_cell_number,
controllers
)Arguments
- config_file
Path to the JSON configuration file. See
create_configfor creating one.- outdir
Path to the output directory. If it does not exist, it will be created.
- fastq
Path to the FASTQ file or a directory containing FASTQ files. Each file will be processed as an individual sample.
- annotation
The file path to the annotation file in GFF3 / GTF format.
- genome_fa
The file path to the reference genome in FASTA format.
- genome_mmi
(optional) The file path to minimap2's index reference genome.
- minimap2
(optional) The path to the minimap2 binary. If not provided, FLAMES will use a copy from bioconda via
basilisk.- samtools
(optional) The path to the samtools binary. If not provided, FLAMES will use a copy from bioconda via
basilisk.- barcodes_file
The file with expected cell barcodes, with each barcode on a new line.
- expect_cell_number
The expected number of cells in the sample. This is used if
barcodes_fileis not provided. SeeBLAZEfor more details.- controllers
(optional, experimental) A
crew_class_controllerobject for running certain steps
Value
A FLAMES.SingleCellPipeline object. The pipeline can be run using
run_FLAMES(pipeline). The results can be accessed with experiment(pipeline).
The pipeline also writes a number of files into the given outdir directory,
for example:
- matched_reads.fastq.gz
- demultiplexed reads (barcode/UMI in the read header)
- align2genome.bam
- sorted BAM file with reads aligned to the genome
- gene_count.mtx, gene_count_features.tsv, gene_count_barcodes.tsv
- gene count matrix (Matrix Market format)
- isoform_annotated.gtf
- updated annotation with novel isoforms (
.gff3when not using bambu)- transcript_assembly.fa
- transcript sequences from the isoforms
- realign2transcript.bam
- sorted realigned BAM file using transcript_assembly.fa as reference
- experiment.rds
- the serialised SingleCellExperiment returned by
experiment(pipeline)
See the Expected output files section of the FLAMES vignette
(vignette("FLAMES_vignette")) for the complete, per-step list
(including the Oarfish and multi-sample variants).
Details
By default the pipeline starts with demultiplexing the input fastq data. If the
cell barcodes are known apriori (e.g. via coupled short-read sequencing), the
barcodes_file argument can be used to specify a file containing the cell
barcodes, and a modified Rcpp version of flexiplex will be used; otherwise,
expect_cell_number need to be provided, and BLAZE will be used to
generate the cell barcodes. The pipeline then aligns the reads to the genome using
minimap2. The alignment is then used for isoform detection (either using
FLAMES or bambu, can be configured). The reads are then realigned
to the detected isoforms. Finally, a transcript count matrix is generated (either
using FLAMES's simplistic counting or oarfish's Expectation
Maximization algorithm, can be configured). The results can be accssed with
experiment(pipeline). If the pipeline errored out / new steps were configured,
it can be resumed by calling resume_FLAMES(pipeline)
See also
create_config for creating a configuration file,
BulkPipeline for bulk long data,
MultiSampleSCPipeline for multi sample single cell pipelines.
Examples
outdir <- tempfile()
dir.create(outdir)
bc_allow <- file.path(outdir, "bc_allow.tsv")
genome_fa <- file.path(outdir, "rps24.fa")
R.utils::gunzip(
filename = system.file("extdata", "bc_allow.tsv.gz", package = "FLAMES"),
destname = bc_allow, remove = FALSE
)
R.utils::gunzip(
filename = system.file("extdata", "rps24.fa.gz", package = "FLAMES"),
destname = genome_fa, remove = FALSE
)
ppl <- SingleCellPipeline(
config_file = create_config(
outdir,
pipeline_parameters.demultiplexer = "flexiplex",
pipeline_parameters.do_gene_quantification = FALSE
),
outdir = outdir,
fastq = system.file("extdata", "fastq", "musc_rps24.fastq.gz", package = "FLAMES"),
annotation = system.file("extdata", "rps24.gtf.gz", package = "FLAMES"),
genome_fa = genome_fa,
barcodes_file = bc_allow
)
#> ℹ Writing configuration to: /tmp/RtmpgehRKJ/filebbc02864eb80/config_file_48064.json
#> Warning: You have set to use oarfish quantification without gene quantification. Oarfish currently does not collapse UMIs, and gene quantification performs UMI collapsing. You may want to set do_gene_quantification to TRUE for more accurate results.
#> Configured steps:
#> barcode_demultiplex: TRUE
#> genome_alignment: TRUE
#> gene_quantification: FALSE
#> isoform_identification: TRUE
#> read_realignment: TRUE
#> transcript_quantification: TRUE
#> samtools not found, will use Rsamtools package instead
ppl <- run_FLAMES(ppl)
#> FLAMES version 2.7.1 (unknown source)
#> ── Running step: barcode_demultiplex @ Thu Aug 13 10:09:22 2026 ────────────────
#> Using flexiplex for barcode demultiplexing.
#> Loading known barcodes from /tmp/RtmpgehRKJ/filebbc02864eb80/bc_allow.tsv
#> Number of known barcodes: 143
#> FLEXIPLEX 1.02.6
#> Setting max flanking sequence edit distance to 8
#> Setting number of threads to 8
#> Search pattern:
#> primer: CTACACGACGCTCTTCCGATCT
#> CB: NNNNNNNNNNNNNNNN
#> UB: NNNNNNNNNNNN
#> polyT: TTTTTTTTT
#> CB:Z: tag field: CB
#> Processing file: /__w/_temp/Library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
#> Searching for barcodes...
#> Number of reads processed: 393
#> Number of reads where at least one barcode was found: 368
#> Number of chimera reads: 1
#> All done!
#> Reads Barcodes
#> 10 2
#> 9 2
#> 8 5
#> 7 4
#> 6 3
#> 5 7
#> 4 14
#> 3 14
#> 2 29
#> 1 57
#> ── Running step: genome_alignment @ Thu Aug 13 10:09:23 2026 ───────────────────
#> Creating junction bed file from GFF3 annotation.
#> Aligning sample /tmp/RtmpgehRKJ/filebbc02864eb80/matched_reads.fastq.gz -> /tmp/RtmpgehRKJ/filebbc02864eb80/align2genome.bam
#> Warning: samtools not found, using Rsamtools instead, this could be slower and might fail for large BAM files.
#> Sorting BAM files by genome coordinates with 8 threads...
#> Indexing bam files
#> ── Running step: isoform_identification @ Thu Aug 13 10:09:23 2026 ─────────────
#> ── Running step: read_realignment @ Thu Aug 13 10:09:23 2026 ───────────────────
#> Checking for fastq file(s) /__w/_temp/Library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
#> files found
#> Checking for fastq file(s) /tmp/RtmpgehRKJ/filebbc02864eb80/matched_reads.fastq.gz
#> files found
#> Checking for fastq file(s) /tmp/RtmpgehRKJ/filebbc02864eb80/matched_reads_dedup.fastq.gz
#> files not found
#> Warning: Oarfish does not support UMI deduplication, you should deduplicate reads before running Oarfish
#> Realigning sample /tmp/RtmpgehRKJ/filebbc02864eb80/matched_reads.fastq.gz -> /tmp/RtmpgehRKJ/filebbc02864eb80/realign2transcript.bam
#> Warning: samtools not found, using Rsamtools instead, this could be slower and might fail for large BAM files.
#> Sorting BAM files by 8 with CB threads...
#> ── Running step: transcript_quantification @ Thu Aug 13 10:09:23 2026 ──────────
experiment(ppl)
#> class: SingleCellExperiment
#> dim: 10 137
#> metadata(0):
#> assays(1): counts
#> rownames(10): ENSMUSG00000025290.17_19_5159_1
#> ENSMUSG00000025290.17_19_5159_2 ... ENSMUST00000169826.2
#> ENSMUST00000225023.1
#> rowData names(6): transcript_id source ... rank gene_id
#> colnames(137): AACCATGAGTCGTTTG AACTCTTGTCACCTAA ... TTGTAGGTCAGTGTTG
#> TTTATGCAGACTAGAT
#> colData names(0):
#> reducedDimNames(0):
#> mainExpName: NULL
#> altExpNames(0):