Skip to contents

Create a Flexiplex barcode segment

Source: R/find_barcode.R
barcode_segment.Rd

Creates a FlexiplexSegment object describing one component of a read's barcode structure. A list of segments is passed to find_barcode (via the segments argument) to define how reads are parsed from 5' to 3'.

Usage

barcode_segment(
  type = "FIXED",
  pattern,
  name,
  bc_list = NA_character_,
  group = NA_character_,
  buffer_size = 2,
  max_edit_distance = 2
)

Arguments

type

Segment type: one of "FIXED", "MATCHED", "RANDOM", or "MATCHED_SPLIT".

pattern

The nucleotide pattern for this segment. For FIXED: the known sequence (e.g. "CTACACGACGCTCTTCCGATCT"). For MATCHED/MATCHED_SPLIT: an N-repeat matching the expected barcode length (e.g. "NNNNNNNNNNNNNNNN" for a 16-nt barcode). For RANDOM: an N-repeat matching the UMI length (e.g. "NNNNNNNNNNNN" for a 12-nt UMI). Other IUPAC ambigious codes such as "Y" "R" are also supported, e.g. "NNNYNNNRNNN", "CTACACGACGCTCTTCCGATCTNNN"

name

Label for this segment in output files (e.g. "CB" for cell barcode, "UB" for UMI, "primer"). Defaults to "FIXED_SEGMENT" for FIXED segments.

bc_list

For MATCHED segments: a key used to look up the barcode allow-list file from the barcodes_files argument of find_barcode. The key must match a name in barcodes_files, or barcodes_files can be a single unnamed path (in which case bc_list may be omitted).

group

For MATCHED_SPLIT segments: the name of the barcode_group this segment belongs to. Must match the name of a barcode_group object passed to find_barcode.

buffer_size

Non-negative integer. Extra nucleotides searched on each side of the expected segment position to accommodate small insertions/deletions. Only applies to MATCHED and MATCHED_SPLIT segments. Default: 2.

max_edit_distance

Non-negative integer. Maximum edit distance allowed when matching a read sequence against the barcode allow-list. Only applies to MATCHED and MATCHED_SPLIT segments. Default: 2.

Value

A FlexiplexSegment object for use in find_barcode.

Details

Four segment types are supported:

"FIXED"

A known, constant flanking sequence (e.g. a sequencing primer or poly-T tail). Used as an alignment anchor; i.e. no barcode allow-list is associated

"MATCHED"

A variable sequence matched against a barcode allow-list (e.g. a cell barcode). The allow-list file is resolved via the barcodes_files argument of find_barcode. bc_list must be supplied (or barcodes_files must be a single unnamed path).

"RANDOM"

A random sequence of fixed length captured verbatim without matching (e.g. a UMI). No allow-list is needed.

"MATCHED_SPLIT"

Like "MATCHED", but participates in a barcode_group for multi-segment barcode matching, where the all MATCHED_SPLIT segments of the same group are concatenated and then matched to the allow-list barcodes. group must name a corresponding barcode_group.

See also

barcode_group, find_barcode

Examples

# A typical 10x Genomics 3' v3 barcode structure:
segments <- list(
  barcode_segment(type = "FIXED",   pattern = "CTACACGACGCTCTTCCGATCT", name = "primer"),
  barcode_segment(type = "MATCHED", pattern = "NNNNNNNNNNNNNNNN",        name = "CB",
                  bc_list = "CB", buffer_size = 5, max_edit_distance = 2),
  barcode_segment(type = "RANDOM",  pattern = "NNNNNNNNNNNN",            name = "UB"),
  barcode_segment(type = "FIXED",   pattern = "TTTTTTTTT",               name = "polyT")
)