Skip to contents

Create SingleCellExperiment object from FLAMES output folder

Usage

create_sce_from_dir(outdir, annotation, quantification = "FLAMES")

Arguments

outdir

The folder containing FLAMES output files

annotation

the annotation file that was used to produce the output files

quantification

(Optional) the quantification method used to generate the output files (either "FLAMES" or "Oarfish".). If not specified, the function will attempt to determine the quantification method.

Value

a list of SingleCellExperiment objects if multiple transcript matrices were found in the output folder, or a SingleCellExperiment object if only one were found

Examples

outdir <- tempfile()
dir.create(outdir)
bc_allow <- file.path(outdir, "bc_allow.tsv")
genome_fa <- file.path(outdir, "rps24.fa")
R.utils::gunzip(
  filename = system.file("extdata", "bc_allow.tsv.gz", package = "FLAMES"),
  destname = bc_allow, remove = FALSE
)
R.utils::gunzip(
  filename = system.file("extdata", "rps24.fa.gz", package = "FLAMES"),
  destname = genome_fa, remove = FALSE
)
annotation <- system.file("extdata", "rps24.gtf.gz", package = "FLAMES")

sce <- sc_long_pipeline(
  genome_fa = genome_fa,
  fastq = system.file("extdata", "fastq", "musc_rps24.fastq.gz", package = "FLAMES"),
  annotation = annotation,
  outdir = outdir,
  barcodes_file = bc_allow,
  config_file = create_config(
    outdir,
    pipeline_parameters.demultiplexer = "flexiplex",
    oarfish_quantification = FALSE
  )
)
#> ℹ Writing configuration to: /tmp/RtmpgehRKJ/filebbc0b75dc5c/config_file_48064.json
#> Configured steps: 
#> 	barcode_demultiplex: TRUE
#> 	genome_alignment: TRUE
#> 	gene_quantification: TRUE
#> 	isoform_identification: TRUE
#> 	read_realignment: TRUE
#> 	transcript_quantification: TRUE
#> samtools not found, will use Rsamtools package instead
#> FLAMES version 2.7.1 (unknown source)
#> ── Running step: barcode_demultiplex @ Thu Aug 13 10:09:35 2026 ────────────────
#> Using flexiplex for barcode demultiplexing.
#> Loading known barcodes from /tmp/RtmpgehRKJ/filebbc0b75dc5c/bc_allow.tsv
#> Number of known barcodes: 143
#> FLEXIPLEX 1.02.6
#> Setting max flanking sequence edit distance to 8
#> Setting number of threads to 8
#> Search pattern:
#> primer: CTACACGACGCTCTTCCGATCT
#> CB: NNNNNNNNNNNNNNNN
#> UB: NNNNNNNNNNNN
#> polyT: TTTTTTTTT
#> CB:Z: tag field: CB
#> Processing file: /__w/_temp/Library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
#> Searching for barcodes...
#> Number of reads processed: 393
#> Number of reads where at least one barcode was found: 368
#> Number of chimera reads: 1
#> All done!
#> Reads	Barcodes
#> 10	2
#> 9	2
#> 8	5
#> 7	4
#> 6	3
#> 5	7
#> 4	14
#> 3	14
#> 2	29
#> 1	57
#> ── Running step: genome_alignment @ Thu Aug 13 10:09:35 2026 ───────────────────
#> Creating junction bed file from GFF3 annotation.
#> Aligning sample /tmp/RtmpgehRKJ/filebbc0b75dc5c/matched_reads.fastq.gz -> /tmp/RtmpgehRKJ/filebbc0b75dc5c/align2genome.bam
#> Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
#> Warning: samtools not found, using Rsamtools instead, this could be slower and might fail for large BAM files.
#> Sorting BAM files by genome coordinates with 8 threads...
#> Indexing bam files
#> ── Running step: gene_quantification @ Thu Aug 13 10:09:35 2026 ────────────────
#> 10:09:35 AM Thu Aug 13 2026 quantify genes 
#> Using BAM(s): /tmp/RtmpgehRKJ/filebbc0b75dc5c/align2genome.bam
#> ── Running step: isoform_identification @ Thu Aug 13 10:09:36 2026 ─────────────
#> ── Running step: read_realignment @ Thu Aug 13 10:09:37 2026 ───────────────────
#> Checking for fastq file(s) /__w/_temp/Library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
#> 	files found
#> Checking for fastq file(s) /tmp/RtmpgehRKJ/filebbc0b75dc5c/matched_reads.fastq.gz
#> 	files found
#> Checking for fastq file(s) /tmp/RtmpgehRKJ/filebbc0b75dc5c/matched_reads_dedup.fastq.gz
#> 	files found
#> Realigning sample /tmp/RtmpgehRKJ/filebbc0b75dc5c/matched_reads_dedup.fastq.gz -> /tmp/RtmpgehRKJ/filebbc0b75dc5c/realign2transcript.bam
#> Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
#> Warning: samtools not found, using Rsamtools instead, this could be slower and might fail for large BAM files.
#> Sorting BAM files by genome coordinates with 8 threads...
#> Indexing bam files
#> ── Running step: transcript_quantification @ Thu Aug 13 10:09:37 2026 ──────────
#> 10:09:37 AM Thu Aug 13 2026 quantify transcripts 
#> Warning: Annotation in GFF format may cause errors. Please consider using GTF formats.
#> Found realignment file(s): 	realign2transcript.bam
#> Pipeline saved to /tmp/RtmpgehRKJ/filebbc0b75dc5c/pipeline.rds
sce_2 <- create_sce_from_dir(outdir, annotation)