Pipeline for Single Cell Data (deprecated)

This function is deprecated. Please use [SingleCellPipeline()] instead.

Usage

sc_long_pipeline(
  annotation,
  fastq,
  outdir,
  genome_fa,
  minimap2 = NULL,
  barcodes_file = NULL,
  expect_cell_number = NULL,
  config_file = NULL
)

Arguments

annotation: The file path to the annotation file in GFF3 format
fastq: The file path to input fastq file
outdir: The path to directory to store all output files.
genome_fa: The file path to genome fasta file.
minimap2: Path to minimap2, optional.
barcodes_file: The file with expected cell barcodes, with each barcode on a new line.
expect_cell_number: The expected number of cells in the sample. This is used if barcodes_file is not provided. See BLAZE for more details.
config_file: File path to the JSON configuration file.

Value

A SingleCellPipeline object containing the transcript counts.

Examples

outdir <- tempfile()
dir.create(outdir)
bc_allow <- file.path(outdir, "bc_allow.tsv")
genome_fa <- file.path(outdir, "rps24.fa")
R.utils::gunzip(
  filename = system.file("extdata", "bc_allow.tsv.gz", package = "FLAMES"),
  destname = bc_allow, remove = FALSE
)
R.utils::gunzip(
  filename = system.file("extdata", "rps24.fa.gz", package = "FLAMES"),
  destname = genome_fa, remove = FALSE
)
sce <- FLAMES::sc_long_pipeline(
  genome_fa = genome_fa,
  fastq = system.file("extdata", "fastq", "musc_rps24.fastq.gz", package = "FLAMES"),
  annotation = system.file("extdata", "rps24.gtf.gz", package = "FLAMES"),
  outdir = outdir,
  barcodes_file = bc_allow
)
#> No config file provided, creating a default config in /tmp/RtmpA5lNG6/file329065c44de6 
#> Writing configuration parameters to:  /tmp/RtmpA5lNG6/file329065c44de6/config_file_12944.json 
#> Configured steps: 
#> 	barcode_demultiplex: TRUE
#> 	genome_alignment: TRUE
#> 	gene_quantification: TRUE
#> 	isoform_identification: TRUE
#> 	read_realignment: TRUE
#> 	transcript_quantification: TRUE
#> samtools not found, will use Rsamtools package instead
#> ── Running step: barcode_demultiplex @ Mon Jun 23 02:42:51 2025 ────────────────
#> FLEXIPLEX 0.96.2
#> Setting max barcode edit distance to 2
#> Setting max flanking sequence edit distance to 8
#> Setting read IDs to be  replaced
#> Setting number of threads to 8
#> Search pattern: 
#> primer: CTACACGACGCTCTTCCGATCT
#> BC: NNNNNNNNNNNNNNNN
#> UMI: NNNNNNNNNNNN
#> polyT: TTTTTTTTT
#> Setting known barcodes from /tmp/RtmpA5lNG6/file329065c44de6/bc_allow.tsv
#> Number of known barcodes: 143
#> Processing file: /__w/_temp/Library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
#> Searching for barcodes...
#> Number of reads processed: 393
#> Number of reads where at least one barcode was found: 368
#> Number of reads with exactly one barcode match: 364
#> Number of chimera reads: 1
#> All done!
#> ── Running step: genome_alignment @ Mon Jun 23 02:42:51 2025 ───────────────────
#> Creating junction bed file from GFF3 annotation.
#> Aligning sample /tmp/RtmpA5lNG6/file329065c44de6/matched_reads.fastq.gz -> /tmp/RtmpA5lNG6/file329065c44de6/align2genome.bam
#> Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
#> Warning: samtools not found, using Rsamtools instead, this could be slower and might fail for large BAM files.
#> Sorting BAM files by genome coordinates with 8 threads...
#> Indexing bam files
#> ── Running step: gene_quantification @ Mon Jun 23 02:42:51 2025 ────────────────
#> 02:42:51 AM Mon Jun 23 2025 quantify genes 
#> Using BAM(s): /tmp/RtmpA5lNG6/file329065c44de6/align2genome.bam
#> ── Running step: isoform_identification @ Mon Jun 23 02:42:52 2025 ─────────────
#> Import genomic features from the file as a GRanges object ... 
#> OK
#> Prepare the 'metadata' data frame ... 
#> OK
#> Make the TxDb object ... 
#> Warning: genome version information is not available for this TxDb object
#> OK
#> ── Running step: read_realignment @ Mon Jun 23 02:42:52 2025 ───────────────────
#> Checking for fastq file(s) /__w/_temp/Library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
#> 	files found
#> Checking for fastq file(s) /tmp/RtmpA5lNG6/file329065c44de6/matched_reads.fastq.gz
#> 	files found
#> Checking for fastq file(s) /tmp/RtmpA5lNG6/file329065c44de6/matched_reads_dedup.fastq.gz
#> 	files found
#> Realigning sample /tmp/RtmpA5lNG6/file329065c44de6/matched_reads_dedup.fastq.gz -> /tmp/RtmpA5lNG6/file329065c44de6/realign2transcript.bam
#> Warning: samtools not found, using Rsamtools instead, this could be slower and might fail for large BAM files.
#> Sorting BAM files by 8 with CB threads...
#> ── Running step: transcript_quantification @ Mon Jun 23 02:42:52 2025 ──────────
#> Import genomic features from the file as a GRanges object ... 
#> OK
#> Prepare the 'metadata' data frame ... 
#> OK
#> Make the TxDb object ... 
#> Warning: genome version information is not available for this TxDb object
#> OK
#> Import genomic features from the file as a GRanges object ... 
#> OK
#> Prepare the 'metadata' data frame ... 
#> OK
#> Make the TxDb object ... 
#> Warning: genome version information is not available for this TxDb object
#> OK
#> Pipeline saved to /tmp/RtmpA5lNG6/file329065c44de6/pipeline.rds

Usage

Arguments

Value

See also

Examples