Skip to contents

Differential transcription usage testing for single cell data, using colLabels as cluster labels.

Usage

sc_DTU_analysis(
  sce,
  gene_col = "gene_id",
  min_count = 15,
  threads = 1,
  method = "transcript usage permutation",
  permuations = 1000
)

Arguments

sce

The SingleCellExperiment object, with transcript counts in the counts slot and cluster labels in the colLabels slot.

gene_col

The column name in the rowData slot of sce that contains the gene ID / name. Default is "gene_id".

min_count

The minimum total counts for a transcript to be tested.

threads

Number of threads to use for parallel processing.

method

The method to use for testing, listed in details.

permuations

Number of permutations for permutation methods.

Value

a tibble containing the following columns:

p.value

- the raw p-value

adj.p.value

- multiple testing adjusted p-value

cluster

- the cluster where DTU was observed

transcript

- rowname of sce, the DTU isoform

transcript_usage

- the transcript usage of the isoform in the cluster

Additional columns from method = "transcript usage permutation":

transcript_usage_elsewhere

- transcript usage in other clusters

usage_difference

- the difference between the two transcript usage

permuted_var

- the variance of usage difference in the permuted data

Additional columns from method = "chisq":

X_value

- the test statistic

df

- the degrees of freedom

expected_usage

- the expected usage (mean across all clusters)

usage_difference

- the difference between the observed and expected usage

The table is sorted by P-values.

Details

Genes with more than 2 isoforms expressing more than min_count counts are selected for testing with one of the following methods:

transcript usage permutation

Transcript usage are taken as the test statistic, cluster labels are permuted to generate a null distribution.

chisq

Chi-square test of the transcript count matrix for each gene.

Adjusted P-values were calculated by Benjamini–Hochberg correction.

Examples

outdir <- tempfile()
dir.create(outdir)
bc_allow <- file.path(outdir, "bc_allow.tsv")
genome_fa <- file.path(outdir, "rps24.fa")
R.utils::gunzip(
  filename = system.file("extdata", "bc_allow.tsv.gz", package = "FLAMES"),
  destname = bc_allow, remove = FALSE
)
R.utils::gunzip(
  filename = system.file("extdata", "rps24.fa.gz", package = "FLAMES"),
  destname = genome_fa, remove = FALSE
)

sce <- FLAMES::sc_long_pipeline(
  genome_fa = genome_fa,
  fastq = system.file("extdata", "fastq", "musc_rps24.fastq.gz", package = "FLAMES"),
  annotation = system.file("extdata", "rps24.gtf.gz", package = "FLAMES"),
  outdir = outdir,
  barcodes_file = bc_allow,
  config_file = create_config(
    outdir,
    pipeline_parameters.demultiplexer = "flexiplex"
  )
)
#>  Writing configuration to: /tmp/Rtmp4nGYdi/filebc443b663cad/config_file_48196.json
#> Configured steps: 
#> 	barcode_demultiplex: TRUE
#> 	genome_alignment: TRUE
#> 	gene_quantification: TRUE
#> 	isoform_identification: TRUE
#> 	read_realignment: TRUE
#> 	transcript_quantification: TRUE
#> samtools not found, will use Rsamtools package instead
#> ── Running step: barcode_demultiplex @ Fri Jun 26 08:25:32 2026 ────────────────
#> Using flexiplex for barcode demultiplexing.
#> Loading known barcodes from /tmp/Rtmp4nGYdi/filebc443b663cad/bc_allow.tsv
#> Number of known barcodes: 143
#> FLEXIPLEX 1.02.6
#> Setting max flanking sequence edit distance to 8
#> Setting number of threads to 8
#> Search pattern:
#> primer: CTACACGACGCTCTTCCGATCT
#> CB: NNNNNNNNNNNNNNNN
#> UB: NNNNNNNNNNNN
#> polyT: TTTTTTTTT
#> CB:Z: tag field: CB
#> Processing file: /__w/_temp/Library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
#> Searching for barcodes...
#> Number of reads processed: 393
#> Number of reads where at least one barcode was found: 368
#> Number of chimera reads: 1
#> All done!
#> Reads	Barcodes
#> 10	2
#> 9	2
#> 8	5
#> 7	4
#> 6	3
#> 5	7
#> 4	14
#> 3	14
#> 2	29
#> 1	57
#> ── Running step: genome_alignment @ Fri Jun 26 08:25:32 2026 ───────────────────
#> Creating junction bed file from GFF3 annotation.
#> Aligning sample /tmp/Rtmp4nGYdi/filebc443b663cad/matched_reads.fastq.gz -> /tmp/Rtmp4nGYdi/filebc443b663cad/align2genome.bam
#> Warning: samtools not found, using Rsamtools instead, this could be slower and might fail for large BAM files.
#> Sorting BAM files by genome coordinates with 8 threads...
#> Indexing bam files
#> ── Running step: gene_quantification @ Fri Jun 26 08:25:32 2026 ────────────────
#> 08:25:32 AM Fri Jun 26 2026 quantify genes 
#> Using BAM(s): /tmp/Rtmp4nGYdi/filebc443b663cad/align2genome.bam
#> ── Running step: isoform_identification @ Fri Jun 26 08:25:33 2026 ─────────────
#> ── Running step: read_realignment @ Fri Jun 26 08:25:33 2026 ───────────────────
#> Checking for fastq file(s) /__w/_temp/Library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
#> 	files found
#> Checking for fastq file(s) /tmp/Rtmp4nGYdi/filebc443b663cad/matched_reads.fastq.gz
#> 	files found
#> Checking for fastq file(s) /tmp/Rtmp4nGYdi/filebc443b663cad/matched_reads_dedup.fastq.gz
#> 	files found
#> Realigning sample /tmp/Rtmp4nGYdi/filebc443b663cad/matched_reads_dedup.fastq.gz -> /tmp/Rtmp4nGYdi/filebc443b663cad/realign2transcript.bam
#> Warning: samtools not found, using Rsamtools instead, this could be slower and might fail for large BAM files.
#> Sorting BAM files by 8 with CB threads...
#> ── Running step: transcript_quantification @ Fri Jun 26 08:25:33 2026 ──────────
#> Pipeline saved to /tmp/Rtmp4nGYdi/filebc443b663cad/pipeline.rds
group_anno <- data.frame(barcode_seq = colnames(sce), groups = SingleCellExperiment::counts(sce)["ENSMUST00000169826.2", ] > 1)
SingleCellExperiment::colLabels(sce) <- group_anno$groups
# DTU with permutation testing:
sc_DTU_analysis(sce, min_count = 1, method = "transcript usage permutation")
#> Filtering for genes with at least 2 isoforms expressing more than 1 counts ...
#> 	1 gene(s), 8 transcript(s) left.
#> 
  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |======================================================================| 100%
#> 
#> # A tibble: 16 × 9
#>    transcript   cluster transcript_usage transcript_usage_els…¹ usage_difference
#>    <chr>        <fct>              <dbl>                  <dbl>            <dbl>
#>  1 ENSMUSG0000… FALSE             0.0909                 0.0261         0.0648  
#>  2 ENSMUSG0000… TRUE              0.0261                 0.0909        -0.0648  
#>  3 ENSMUST0000… FALSE             0.608                  0.755         -0.147   
#>  4 ENSMUST0000… TRUE              0.755                  0.608          0.147   
#>  5 ENSMUSG0000… FALSE             0.0568                 0.0201         0.0367  
#>  6 ENSMUSG0000… TRUE              0.0201                 0.0568        -0.0367  
#>  7 ENSMUSG0000… FALSE             0.119                  0.0909         0.0284  
#>  8 ENSMUSG0000… FALSE             0.0341                 0.0234         0.0106  
#>  9 ENSMUSG0000… FALSE             0.0568                 0.0446         0.0122  
#> 10 ENSMUSG0000… TRUE              0.0909                 0.119         -0.0284  
#> 11 ENSMUSG0000… TRUE              0.0234                 0.0341        -0.0106  
#> 12 ENSMUSG0000… TRUE              0.0446                 0.0568        -0.0122  
#> 13 ENSMUSG0000… FALSE             0.0227                 0.0288        -0.00607 
#> 14 ENSMUSG0000… TRUE              0.0288                 0.0227         0.00607 
#> 15 ENSMUST0000… FALSE             0.0114                 0.0111         0.000224
#> 16 ENSMUST0000… TRUE              0.0111                 0.0114        -0.000224
#> # ℹ abbreviated name: ¹​transcript_usage_elsewhere
#> # ℹ 4 more variables: p.value <dbl>, permuted_var <dbl>, adj.p.value <dbl>,
#> #   gene_id <chr>
# now try with chisq:
sc_DTU_analysis(sce, min_count = 1, method = "chisq")
#> Filtering for genes with at least 2 detected isoforms ...
#> 	8 isoform(s) left.
#> Aggregating counts by cluster labels ...
#> 
  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |======================================================================| 100%
#> 
#> # A tibble: 1 × 10
#>   gene  X_value    df transcript cluster p.value expected_usage transcript_usage
#>   <chr>   <dbl> <int> <chr>      <chr>     <dbl>          <dbl>            <dbl>
#> 1 ENSM…    12.8     7 ENSMUSG00… FALSE    0.0769         0.0421           0.0909
#> # ℹ 2 more variables: usage_difference <dbl>, adj.p.value <dbl>